DOI: 10.24075/vrgmu.2018.022

ОРИГИНАЛЬНОЕ ИССЛЕДОВАНИЕ

Экспериментальные подходы к таргетному редактированию гена CFTR с помощью CRISPR-Cas9

С. А. Смирнихина1, А. А. Анучина1, К. С. Кочергин-Никитский1, Э. П. Адильгереева1, В. Д. Якушина1, А. В. Лавров1,2
Информация об авторах

1 Лаборатория мутагенеза,
Медико-генетический научный центр, Москва

2 Кафедра молекулярной и клеточной генетики, медико-биологический факультет,
Российский национальный исследовательский медицинский университет имени Н. И. Пирогова, Москва

Для корреспонденции: Светлана Анатольевна Смирнихина
ул. Москворечье, д. 1, г. Москва, 115522; moc.liamg@sanihkinrims

Информация о статье

Финансирование: раздел «Редактирование CFTR локуса» поддержан грантом РНФ (Соглашение № 17-75-20095), разделы «Увеличение экспрессии направляющих РНК» и «Увеличение эффективности редактирования CFTR локуса» поддержаны Российской академией наук и государственным заданием ФГБНУ «МГНЦ».

Статья получена: 15.03.2018 Статья принята к печати: 20.03.2018
|

Муковисцидоз (МВ, OMIM#219700) — аутосомно-рецессивное заболевание, обусловленное мутациями в гене CFTR (cystic fibrosis transmembrane conductance regulator), приводящими к нарушению транспорта ионов хлора и натрия через клеточную мембрану. Это одно из самых распространенных наследственных заболеваний с частотой встречаемости 1 на 4500 человек, при этом частота носительства мутаций гена CFTR достигает 1 на 25 человек [1]. Основные клинические симптомы связаны с поражением легких, являющимся основной причиной смерти пациентов [2], однако могут также вовлекаться поджелудочная железа, печень, кишечник. Самой частой мутацией в гене CFTR является F508del, приводящая к нарушению созревания белка CFTR и его полному отсутствию на поверхности клеток [3]. Патогенетическая терапия МВ в последние десятилетия достигла существенных результатов [47], однако этиотропного лечения до сих пор не существует.

Технологии геномного редактирования, включая использование CRISPR-Cas9, позволяют по-новому взглянуть на возможности генной терапии наследственных заболеваний [8]. Их можно использовать для коррекции («редактирования») мутаций и разрабатывать этиотропную терапию неизлечимых до сих пор болезней [912]. Опубликованные ранее работы по исправлению мутации F508del с помощью различных методов геномного редактирования [1320] позволяют на их основе развивать и совершенствовать новые подходы к редактированию F508del. Существенный недостаток опубликованных работ — крайне низкая эффективность успешного редактирования (<<1% клеток), что является общей проблемой технологии геномного редактирования.

Для разработки более эффективного способа коррекции мутации F508del мы подобрали несколько направляющих РНК на место вокруг мутации и использовали разные ранее не использованные для этих целей ортологи Cas9, создав таким образом несколько комбинаций Cas9 + sgРНК для определения наиболее эффективной.

Целью работы было сравнение эффективности способов коррекции мутации F508del с помощью различных комбинаций направляющих РНК и Cas9 и повышение эффективности редактирования.

МАТЕРИАЛЫ И МЕТОДЫ

Исходные плазмиды для CRISPR-Cas9 были любезно предоставлены Feng Zhang (Addgene #71814 и #61591) и Keith Joung (Addgene #72249). Направляющие РНК (sgRNA) для SpCas9, SpCas9(HF4) и SaCas9 подобрали с помощью свободного программного обеспечения, разработанного Broad Institute (США) (http://portals. broadinstitute.org/gpp/public/analysis-tools/sgrna-design). В результате клонирования получили плазмиды (рис. 1). Для проверки эффективности полученных систем локус вокруг мутации F508del в 400 п.о. клонировали в плазмиду pGEM-TA-CFTR, которую котрансфицировали с плазмидой, экспрессирующей Cas9 и sgRNA. Клеточную культуру HEK293Т (любезно предоставлена к. б. н. М. Ю. Скобловым, лаборатория функциональной геномики ФГБНУ «МГНЦ», Москва), культивировали в DMEM (ПанЭко, Россия) с добавлением 10% эмбриональной бычьей сыворотки (PAA Laboratories GmbH, Австрия), 100 U/мл/100 мкг/мл пенициллин/стрептомицина и 4 мМ L-глутамина (ПанЭко, Россия). Для проверки роли температуры культивирования клетки после трансфекции культивировали в двух условиях: стандартных и при пониженной температуре. По стандартной методике культивировали 72 ч при 37 °С; при втором способе клетки сначала культивировали 24 ч при 37 °С, затем 48 ч при 30 °С. Кальций-фосфатную трансфекцию клеток HEK293T проводили в 12-луночных планшетах при 50% конфлуентности, как описано ранее [21], суммарное количество плазмид на лунку составляло 1,5 или 5,5 мкг (при котрансфекции 1 или 5 мкг плазмиды с Cas9 и sgRNA и 0,5 мкг целевой плазмиды). Через 6 ч после трансфекции среду меняли на полную ростовую, содержащую 10% эмбриональной бычьей сыворотки. В качестве репортерной плазмиды использовали pEGFP-С1 (Clontech, США). Выделение ДНК проводили с помощью набора Genomic DNA-Tissue MiniPrep (ZymoResearch, США), согласно протоколу производителя. T7E1-анализ проводили, как описано ранее [22]: продукты амплификации фрагмента ДНК с предположительными вставками-делециями на месте двухцепочечного разреза подвергали нагреву и резкому охлаждению, образование гетеродуплексов фиксировали по наличию дополнительных полос при электрофорезе после обработки гетеродуплексов эндонуклеазой T7E1.

РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЯ

Редактирование CFTR-локуса

В работе проводили сравнение эффективности геномного редактирования мутации F508del в гене CFTR с использованием двух мутировавших SpCas9 (eSpCas9(1.1) [23] и SpCas9(HF4) [24]) и SaCas9 [25] с разными sgRNA в области мутации. Для SpCas9 подобрали три sgRNA на последовательность 10 экзона гена CFTR в месте мутации F508del (рис. 2). При этом PAM-последовательность для sgCFTR#1 появлялась только при наличии мутации F508del. Вторую sgRNA (sgCFTR#2) подобрали на последовательность ДНК рядом с мутацией, с ее помощью можно редактировать как последовательность с мутацией, так и дикий тип. Третью sgRNA (sgCFTR#3) подобрали на последовательность, находящуюся в 85 нуклеотидах от мутации [13]. SaCas9 использует в своей работе другой PAM, вследствие чего для этой нуклеазы подобрали отдельную sgRNA (saCFTR#3) — непосредственно на мутацию. Из-за того, что в клеточной культуре HEK293T отсутствует мутация F508del и организация геномного сайта предположительно может влиять на эффективность редактирования, sgRNA тестировали также на специально созданной плазмиде с локусом вокруг мутации F508del, которую котрансфицировали с плазмидой, экспрессирующей Cas9 и sgRNA.

Наиболее эффективной комбинацией Cas9 и sgRNA оказалась комбинация SaCas9–saCFTR#3 — произошло редактирование 29% аллелей (рис. 3). SgCFTR#1 в комбинации с разными SpCas9 продемонстрировала в среднем эффективность редактирования, равную 13%. SgCFTR#2 показала эффективность редактирования в среднем 18% (16% на плазмидном сайте и 22% — на геномном), sgCFTR#3 — в среднем 12% (6% на плазмидном сайте и 14% — на геномном). Активность редактирования с использованием sgCFTR#1 сопоставима или ниже активности других направляющих РНК, в том числе контрольной sgGFP, подобранной на ген EGFP (рис. 3).

Увеличение экспрессии направляющих РНК

Проведенная ранее работа показала, что невысокая эффективность редактирования с помощью sgCFTR#1 коррелирует с низким уровнем экспрессии этой sgRNA [22]. С целью увеличения экспрессии sgCFTR#1 в плазмиду добавили дополнительную кассету промотор + sgCFTR#1 (SpCas9–sgCFTR#1–DOUBLE), однако она не оказала существенного влияния на эффективность работы этой направляющей РНК (рис. 4). В работе использовали высокоэффективную sgRNA, подобранную к гену EGFP (sgGFP), в качестве положительного контроля. Так как sgGFP всегда активно экспрессировалась и показывала высокую эффективность, мы соединили две sgRNA, т. е. sgGFP и sgCFTR#1 (SpCas9–sgGFP–sgCFTR#1), однако слитная sgRNA привела к снижению эффективности редактирования локуса CFTR (рис. 4).

В ряде работ показано, что экспрессию можно увеличить с помощью гибридного промотора, т. е. состоящего из двух слитных промоторов [26]. Вероятный механизм действия — привлечение разными промоторами разных транскрипционных факторов. В используемых нами плазмидах sgRNA экспрессируется с промотора U6, который является стандартным для CRISPR-Cas9. Однако в ряде работ показано, что экспрессия sgRNA с промотора tRNAgln выше [26, 27]. Поэтому в работе решено было клонировать в плазмиду гибридный промотор, состоящий из промоторов U6 и tRNAgln (добавление HP после названия плазмиды). Как видно на рис. 5, эффективность работы всех sgRNA снизилась, за исключением sgCFTR#1, чья активность незначительно увеличилась.

Увеличение эффективности редактирования CFTR-локуса

Известно, что молекулы sgRNA размером короче 20 нуклеотидов и начинающиеся на G- или GG-нуклеотид более эффективны [28]. SgCFTR#2 и sgCFTR#3 содержали в 5′-области два нуклеотида GG, поэтому в работе укоротили молекулу sgRNA с 5′-конца до 17 нуклеотидов (SpCas9–sgCFTR#2(GG17) и SpCas9–sgCFTR#3(GG17) соответственно). SgCFTR#1 не содержала в 5′-области GG, поэтому ее укоротили до 19 нуклеотидов и заменили начальные нуклеотиды CC на GG (SpCas9– sgCFTR#1(gg19)). Модификации sgCFTR#1 и sgCFTR#3 привели к уменьшению их активности с 20,3 и 11,8 до 8,7% и 0%, соответственно (рис. 6), тогда как модификация sgCFTR#2 увеличила ее эффективность с 10,5 до 22,1%.

Предполагая, что эффективность работы направляющих РНК связана с их стабильностью, к последовательностям sgCFTR#1 и sgGFP с 5′-конца добавили последовательность CACCGGGAGGGCGGGGAGGG, чтобы создать условия для образования G-квадруплексов sgCFTR#1quad и sgGFPquad соответственно, повышающих стабильность sgRNA [29]. Результаты работы показали, что эффективность разрезания таргетной ДНК с использованием измененных направляющих РНК уменьшилась из-за снижения их экспрессии в 2–16 раз относительно немодифицированных sgRNA [22].

Наконец, осуществляли попытки стабилизации нуклеазы SpCas9 с помощью временного культивирования трансфицированных клеток при 30 °С [14, 30]. Эффективность редактирования CFTR в результате этого эксперимента снизилась почти в 2 раза — с 17,6 до 10,9% (таблица).

ОБСУЖДЕНИЕ РЕЗУЛЬТАТОВ

Попытки коррекции мутаций в гене CFTR с помощью геномного редактирования начались в 2012 г. [14], однако до сих пор нет готового эффективного решения. Связано это, прежде всего, с низкой эффективностью данных подходов. Небольшой процент клеток с исправленной мутацией заставляет использовать клеточную селекцию [13, 16], что существенно увеличивает себестоимость методики и удлиняет процесс получения необходимой клеточной культуры. Кроме того, такой подход не позволяет лечить заболевание системно.

Развивающиеся технологии геномного редактирования позволяют усовершенствовать систему, увеличивая ее эффективность и специфичность. В своей работе мы используем более специфичные ферменты для редактирования генома [23, 24], что повышает безопасность методики. Кроме того, мы разрабатываем метод редактирования, работающий только на мутировавшем сайте, используя действие направляющих РНК непосредственно на мутацию F508del. Это открывает новые возможности: должно происходить редактирование не выделенных клеток, а в организме, так как меняться будут только аллели с мутацией. К тому же, новый подход позволит избежать повторного разрезания уже отредактированного локуса. 

Однако в ходе работы было показано, что эффективность редактирования с помощью sgCFTR#1, подобранной на мутацию F508del, ниже по сравнению с большинством используемых нами sgRNA. Основной причиной низкой эффективности стала низкая экспрессия sgCFTR#1 в клетках [22]. Мы испробовали несколько способов усилить экспрессию этой направляющей РНК: добавили в плазмиду дополнительную кассету (промотор + sgCFTR#1), соединили sgCFTR#1 с более активной sgGFP, использовали гибридный промотор U6–tRNAgln, однако ни один из способов не повысил эффективность работы sgCFTR#1.

Ранее было показано, что для инициации транскрипции с промотора U6 необходимо наличие на 5′-конце направляющей РНК нуклеотидов G или GG [28], поэтому мы либо укоротили имеющиеся sgRNA до первой G, либо добавили их вместо начальных нуклеотидов, чтобы повысить экспрессию и, соответственно, активность sgRNA. Однако такой подход также не привел к ожидаемым результатам.

Исходя из того, что изначально у направляющих РНК был одинаковый промотор, а именно U6, можно предположить, что транскрипция обеих sgRNA должна быть одинаковой. Разный уровень экспрессии может быть обусловлен более быстрой деградацией sgCFTR#1 по сравнению с sgGFP. Так, в исследовании скрининга большого числа направляющих РНК [29] показано, что sgRNA, имеющие в своем составе G-богатые участки (более 8 оснований), более стабильны из-за формирования G-квадруплексов. Но, как и в случае экспериментов по усилению экспрессии, G-квадруплекс не увеличил активность sgCFTR#1 [22].

В ряде работ сообщается, что нуклеаза FokI более стабильно работает при 30 °С [14, 30]. Мы предположили, что для нуклеазы Cas9 низкая температура культивирования трансфицированных клеток также може быть эфективной, однако такой подход не привел к повышению активности редактирования [22].

Проведенные in vitro эксперименты показывают, что до 41% направляющих РНК не активны в отношении таргетного локуса [31]. В качестве основной причины рассматривается нуклеотидный состав sgRNA: например, Т- и ТТ-богатые последовательности снижают эффективность [32], присутствие разных нуклеотидов в определенных позициях направляющей РНК также достоверно ассоциировано с разной активностью sgRNA [31]. Кроме того, могут играть роль и вторичные структуры, образуемые направляющими РНК [31]. Если низкая эффективность работы sgRNA связана с ее последовательностью, то единственным решением в таком случае является подбор новой sgRNA.

ВЫВОДЫ

По результатам редактирования локуса CFTR в клеточной культуре HEK293T, наиболее эффективна комбинация из SaCas9 и sgRNA, подобранная на мутацию F508del (редактирование составило 29%). SgCFTR#1, подобранная на мутацию F508del, в комбинации в двумя разными SpCas9 показала наименьшую эффективность: 13,8% — с Cas9(1.1) и 8% — c Cas9(HF4), что связано с ее низкой экспрессией. Предпринятые попытки увеличить экспрессию sgCFTR#1 путем добавления еще одной экспрессирующей кассеты в плазмиду, соединения этой sgRNA с активной sgGFP и использования гибридного промотора, существенного повышения эффективности работы sgCFTR#1 не дали. Попытки стабилизировать sgCFTR#1 путем добавления в ее последовательность G-квадруплекса, укорочения и добавления GG в 5′-область также не принесли результатов. Культивирование редактируемых клеток при более низкой температуре не привело к повышению эффективности редактирования. Таким образом, низкая эффективность работы sgCFTR#1, вероятно, является следствием ее нуклеотидной последовательности, и необходимо использовать другие направляющие РНК, либо другие Cas9, например, SaCas9, с другими PAM- последовательностями, расширяющими возможности подбора направляющих РНК на мутацию F508del.

КОММЕНТАРИИ (0)