DOI: 10.24075/vrgmu.2018.091

ОРИГИНАЛЬНОЕ ИССЛЕДОВАНИЕ

Экспрессия химерного антигенного рецептора в натуральных киллерах линии NK-92 путем трансдукции лентивирусными частицами, псевдотипированными поверхностными гликопротеинами вакцинного штамма вируса кори

Информация об авторах

Группа структурной организации Т-клеточного иммунитета, отдел геномики адаптивного иммунитета, Федеральное государственное бюджетное учреждение науки Институт биоорганической химии им. академиков М.М. Шемякина и Ю.А. Овчинникова Российской академии наук, Москва

Для корреспонденции: Степан Петрович Чумаков
ул. Миклухо-Маклая, 16/10, г. Москва, 117997; moc.liamg@lukhtah

Информация о статье

Финансирование: работа выполнена при финансовой поддержке Министерства образования и науки РФ, уникальный код проекта RFMEFI60716X0156.

Статья получена: 27.11.2018 Статья принята к печати: 20.12.2018 Опубликовано online: 31.12.2018
|

Совершенствование методов клеточной иммунотерапии для борьбы со злокачественными новообразованиями является одним из ключевых направлений развития современной онкологии. Введение в организм иммунных клеток, нацеленных на опухолевые антигены, позволяет добиться высокой специфичности действия и эффективности лечения при низкой частоте развития нежелательных эффектов [1]. В исследовательских работах и при клинических испытаниях часто используют собственные цитотоксические Т-лимфоциты пациента, которым искусственно придается специфичность в отношении определенного опухолевого антигена или их комбинации. Подобные модификации осуществляют за счет экспрессии химерного антигенного рецептора (ХАР), состоящего из нескольких внутриклеточных сигнальных доменов для активации Т-лимфоцита, и внеклеточного участка, распознающего опухолевый антиген [2]. Для введения конструкций, экспрессирующих ХАР, применяют химическую трансфекцию клеток [3], электропорацию [4] или трансдукцию вирусными векторами [5]. После трансдукции клеточная популяция может быть пассирована в культуре для получения необходимого количества клеток. Препараты ХАР-Т-клеток демонстрируют неплохую клиническую эффективность, однако стоимость терапии с их использованием чрезвычайно высока, что объясняется необходимостью производства персонализированной популяции Т-клеток для каждого пациента. Другой причиной невозможности массового применения ХАР-Т- клеток служит ограниченная доступность собственных Т-лимфоцитов у тяжелых онкологических больных. Преодолеть эти барьеры можно, но это потребует существенного совершенствования технологий получения клеточных препаратов.

В качестве менее дорогой и более доступной альтернативы ХАР-Т-клеточным препаратам могут быть использованы унифицированные носители ХАР — линии клеток натуральных киллеров. Из 11 установленных и широко доступных линий натуральных киллеров, полученных от пациентов с различными лимфопролиферативными заболеваниями, только две — KHYG-1 [6] и NK-92 [7] — обладают выраженной способностью подавлять рост опухолевых клеток за счет цитотоксического действия, при отсутствии экспрессии на своей поверхности Т-клеточных рецепторов [8]. Обе клеточные линии способны пролиферировать в присутствии IL2 в культуральной среде, а для NK-92 была показана способность избирательно уничтожать клетки лимфомы линии K-562, культивируемые в смеси с нормальными периферическими мононуклеарными клетками. Клетки линии NK-92 также оказались способными сохранять цитотоксичность после γ-облучения дозой 10 Гр при утрате способности к пролиферации, что позволяет использовать их для терапии онкологических заболеваний [9].

Для усиления цитотоксических свойств NK-92 были созданы генетически модифицированные варианты, экспрессирующие собственные IL2, IL15 [10]; или дополнительные рецепторы CD16 для нацеливания на опухолевые клетки при помощи антител, либо ХАР для прямого распознавания опухолевых антигенов [11]. Функционально ХАР-экспрессирующие NK-92 аналогичны ХАР-Т-клеткам, при этом стоимость терапии может быть значительно ниже, так как линейные клетки можно культивировать в промышленных масштабах, а подготовительные процедуры для лечения пациента будут заключаться лишь в размораживании ампулы готового препарата [12]. Помимо использования для терапии, клетки NK-92 могут служить в качестве клеточной платформы для тестирования различных вариантов химерных рецепторов in vitro и in vivo. Основное препятствие при работе с клетками этой линии заключается в их чувствительности к условиям культивации, а также высокой устойчивости к лентивирусной трансдукции: вирусные векторы, псевдотипированные G-белком вируса везикулярного стоматита (VSV), неэффективно заражают клетки NK-92, а при повышении количества вирусных частиц в среде клетки теряют жизнеспособность [13]. Для проведения лентивирусной трансдукции периферических Т-лимфоцитов и иммунных клеток миелоидного ряда не так давно были испытаны лентивирусные векторные частицы, псевдотипированные поверхностными гликопротеинами вакцинного штамма вируса кори [14]. Было показано, что по сравнению с обычными лентивирусными векторами, псевдотипированными белком G вируса везикулярного стоматита, они обладают более высокой способностью трансдуцировать иммунные клетки, не вызывая при этом стимулирования клеточных делений, смены фенотипа и изменения профиля секретируемых цитокинов [15]. Целью настоящей работы было определить эффективность трансдукции клеток NK-92 лентивирусами, псевдотипированными гликопротеинами F и H вируса кори, определить условия выделения и очистки клеток NK-92, трансдуцированных химерным рецептором, направленным против антигена CD20, а также оценить их цитотоксический потенциал.

МАТЕРИАЛЫ И МЕТОДЫ

Плазмиды и конструкции

Для упаковки лентивирусных векторов, псевдотипированных VSV-G, использовали упаковочные плазмиды psPAX2 (содержит структурные белки лентивируса) и pMD2-G (кодирует G-белок вируса везикулярного стоматита). Обе плазмиды были любезно предоставлены Дидьером Троно (Addgene plasmid # 12260; http://n2t.net/addgene:12260; RRID:Addgene_12260 и Addgene plasmid #12259; http:// n2t.net/addgene:12259; RRID:Addgene_12259). Для псевдотипирования гликопротеинами кори, вместо pMD2-G использовали плазмиду pMD2-FΔ30, кодирующую фрагмент F-белка вируса кори вакцинного штамма ЭШЧ с укороченным на 30 аминокислот цитоплазматическим доменом. Для ревертирования РНК вируса кори и амплификации целевого фрагмента генома применяли праймеры Fdelta30 dir EcoRI (AGAGGAATTCACCACCATGTCCATCATGGGTCTCAAGGTGAACGTCTCTG) и Fdelta30 rev EcoRI (AGAGAGAATTCTCAACGCCCCCTGCAGCAACATATTAAAGCG), клонирование производили в вектор pMD2-G по сайтам EcoRI. В сочетании с pMD2-FΔ30 была использована плазмида pCG-HcΔ18, предоставленная Джейкобом Рейзером (Addgene plasmid # 84817; http://n2t.net/addgene:84817; RRID:Addgene_84817), а также ее варианты, в которых делетированы 24 N-концевых аминокислоты H-белка (pCG-HcΔ24), либо содержащие перед укороченным H-белком дополнительные 4 аминокислотных остатка аланина (pCG-4AHcΔ24). Плазмиды были получены путем клонирования в исходный вектор фрагментов H-белка, амплифицированных с праймерами Hd24 BamHI dir (AGAGAGGGATCCAGGGTG CAAGATCATCCACAATGAACCGGGAGCACCTGATG) и H rev (CTGATGTCTATTTCACACTAGTACAAAC), либо с праймерами Hd24 4a BamHI dir (AGAGAGGGATCCAGGGTGCAAGATCATC CACAATGGCCGCTGCAGCCAACCGGGAGCACCTGATG) и H rev соответственно по сайтам BamHI и SpeI. Для отработки условий трансдукции и испытания цитотоксического действия применяли лентивирусные векторы pLCMV-tagRFP-puro, который содержит последовательность красного флуоресцентного белка tagRFP (Евроген; Россия) под контролем цитомегаловирусного промотора, и pLSF-@ CD20-229-tagRFP, содержащий последовательность химерного рецептора третьего поколения против поверхностного антигена CD20 (лидерный пептид CD8, ScFv из гибридомы HB-9645, эпитоп DYKDDDDK, линкерный участок 229 аминокислот, трансмембранный домен CD28 и сигнальные домены CD28, CD137, CD3z) и tagRFP, экспрессирующиеся полицистронно при помощи сигнальной последовательности T2A под контролем промотора SFFV.

Культуры клеток

Для получения препаратов вируса использовали клетки линии HEK-293Т, которые культивировали в среде DMEM-F12 (PAA; Австрия) с добавлением 10% эмбриональной сыворотки теленка, 2 мМ аланил-глутамина (ПанЭко; Россия), 20 мМ HEPES и по 100 мкг/мл пенициллина и стрептомицина.
Культивацию NK-92 проводили в питательной среде RPMI-1640 (PAA; Австрия) с добавлением 20% эмбриональной сыворотки теленка и сыворотки крови лошади в равных пропорциях, 2 мМ аланил-глутамина (ПанЭко; Россия), 20 мМ HEPES, 0,2 мМ инозитола, 0,1 мМ 2-меркаптоэтанола, 1 мкМ водорастворимого гидрокортизона (Sigma-Aldrich; США), 20 мкМ фолиевой кислоты и рекомбинантного IL2 в конечной концентрации 100 мкг/мл.
В качестве мишеней для ХАР-экспрессирующих клеток NK-92 в работе использовали клетки линии Raji (лимфома Беркитта) (ATCC; США), экспрессирующие флуоресцентный белок GFP. Клетки культивировали в среде RPMI-1640 (ПанЭко; Россия) с добавлением 10% эмбриональной сыворотки теленка, 2 мМ аланил- глутамина (ПанЭко; Россия), 20 мМ HEPES и по 100 мкг/ мл пенициллина и стрептомицина. Все клетки содержали в условиях 5%-го CO2 при 37 °С.

Трансфекция и вирусная трансдукция

Трансфекцию проводили на 6-луночных планшетах в среде для культивации OptiMEM (Invitrogen; США) с использованием полиэтиленимина 25кДА (PEI-25, Polysciences; США) на клетках HEK-293T в плотности 40–60% от монослоя, рассеянных накануне.
Для лентивирусных векторов, псевдотипированных VSV-G, была приготовлена смесь из следующих плазмид: pLCMV-tagRFP-puro, содержащей маркерный белок (1,5 мкг), psPAX2 (0,9 мкг) и pMD2-G (0,6 мкг) в соотношении 5 : 3 : 2 соответственно. Для псевдотипирования гликопротеинами кори использовали плазмиды pLCMV-tagRFP-puro либо pLSF-@CD20-229-tagRFP (0,9 мкг), psPAX2 (0,9 мкг), pMD2-FΔ30 (0,79 мкг), pCG-HcΔ18 (0,11 мкг) или ее вариации pCG-HcΔ24 (0,11 мкг) и pCG-4AHcΔ24 (0,11 мкг) в соотношении 8 : 8 : 7 : 1. После трехчасовой инкубации клеток с трансфекционной смесью среда была заменена на RPMI с содержанием заменителя сыворотки (Serum Replacement Solution, PeproTech; США), 2 мМ аланил- глутамина (ПанЭко; Россия), 20 мМ HEPES и 4 мМ кофеина, в которой HEK-293T инкубировали в течение 24 ч для наработки вирусного препарата. Вирусную трансдукцию проводили в течение 8–12 ч на клетках NK-92, взятых в количестве не менее 5 • 105 в 1 мл. В содержащую вирус среду предварительно добавили полибрен в концентрации 8 мкг/мл и недостающие питательные добавки, входящие в состав среды для культивации клеток NK-92, а также BX795 в концентрации 3 мкМ. Затем среду заменили на обычную для клеток NK-92. Результат трансдукции оценивали через 48 ч. Инфекционный титр вирусных частиц и эффективность трансдукции определяли с помощью проточного цитометра посредством оценки tagRFP-положительной фракции.

Определение цитотоксичности

Для оценки цитотоксичности клетки NK-92 смешивали с клетками Raji, экспрессирующими GFP, в различных соотношениях. После совместной культивации в течение 48 ч на проточном цитометре оценивали долю и количество GFP-положительных клеток.

РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЯ

Определение оптимального соотношения упаковочных плазмид

Для оценки эффективности трансдукции клеток линии NK-92 были использованы препараты лентивирусных частиц, псевдотипированные белком G вируса VSV, либо тремя различными вариантами H-белка вируса кори в сочетании с F-белком (H/F-псевдотипированные). В литературных источниках приводится противоречивая информация об оптимальном соотношении упаковочных плазмид, приводящем к получению наибольших титров вируса [1519]. Соотношения, известные из литературы, а также полученные путем экстраполяции применяемых для упаковки VSV-G-псевдотипированных лентивирусных векторов (вектор : psPAX2 : pMD2-G как 5 : 3 : 2), были использованы для получения препаратов лентивирусов и последующего определения их инфекционного титра (рис. 1). Результаты показали, что соотношения плазмид 8 : 8 : 7 : 1 и 15 : 9 : 2 : 1 для векторов pLCMV-tagRFP-puro : psPAX2 : pMD2-Fd30 : pCG-HΔ18 демонстрировали наиболее эффективную упаковку лентивирусных частиц для варианта белка HΔ18. Для всех дальнейших экспериментов было использовано соотношение 8 : 8 : 7 : 1.

Сравнение вариантов белка Н

Характерной особенностью псевдотипирования H/F- белками является образование синцитиев в культуре клеток-упаковщиков. Длина цитоплазматических участков белков H и F непосредственно влияет на интенсивность этого процесса, и чем менее активно формируются синцитии, тем дольше клетки-упаковщики могут быть использованы для сбора лентивирусных частиц. Избыточное укорачивание цитоплазматических доменов приводит к резкому падению трансфекционного титра. Приводятся данные, что вариант белка HΔ18 в сочетании с белком FΔ30 производит лентивирусные векторные препараты с максимальным транфекционным титром, при этом укорочение до HΔ24 практически полностью подавляет продукцию векторного вируса, а добавление четырех аланиновых остатков на N-конец такого мутанта восстанавливает трансфекционный титр до максимальных значений [16]. В другой работе использовали вариант белка HΔ24 для получения высококонцентрированных лентивирусных препаратов [15]. Результаты проведенного нами сравнения трех вариантов белка Н показали, что размер и скорость образования синцитиев максимальны для варианта белка HΔ18, существенно ниже у варианта 4A-HΔ24 и минимальны у HΔ24 (рис. 2); трансфекционный титр также был максимален при использовании варианта HΔ18, однако для варианта 4A-HΔ24 полученный трансфекционный титр лишь незначительно уступал варианту HΔ18, а для варианта HΔ24 был, как минимум, на 2 порядка ниже, чем у варианта HΔ18. В дальнейших опытах использовали лентивирусные частицы, псевдотипированные белками HΔ18/FΔ30. При измерении на клетках HEK- 293 средний вирусный титр H/F-псевдотипированных лентивирусных препаратов был в 15–20 раз ниже, чем при псевдотипировании белком G вируса VSV (таблица).

Оптимизация условий трансдукции клеток NK-92

Использование VSV-G-псевдотипированных лентивирусных препаратов для трансдукции клеток NK-92 показало, что превышение титра ~105 и. е. на 1 мл среды в течение 8 ч приводит к существенному падению жизнеспособности культуры. Кроме того, клетки NK-92 гораздо менее эффективно трансдуцировались такими лентивирусами, различие в трансфекционном титре по сравнению с HEK- 293 составляло более 3-х порядков. Для повышения эффективности трансдукции натуральных киллеров предложено применять ингибитор TBK1/IKKɛ BX795 в концентрации 6–8 мкМ [20]. Оценка влияния BX795 на жизнеспособность клеток NK-92 показала, что они сохраняют жизнеспособность при концентрациях до 3 мкМ (рис. 3). Применение BX795 позволило снизить разницу в эффективности трансдукции VSV-G-псевдотипированными вирусными частицами в 300 раз. В тех же условиях трансдукции H/F-псевдотипированные лентивирусные препараты оказались способными трансдуцировать клетки NK-92 в три раза менее эффективно по сравнению с клетками HEK-293.

Оценка цитотоксического действия ХАР-трансдуцированных клеток NK-92

Поскольку клетки NK-92 плохо поддаются культивации в низкой плотности, использованные величины соотношения клетка : инфекционная единица не позволяли получить достаточно высокую долю трансдуцированных клеток. Выделение фракции, экспрессирующей tagRFP, при помощи проточного сортировщика позволило получить небольшие фракции ХАР-экспрессирующих клеток, однако сопутствующий стресс приводил к существенной потере жизнеспособности. Для решения этой проблемы мы применили сортировку ХАР-экспрессирующих клеток при помощи магнитных частиц, покрытых моноклональными антителами к эпитопу DYKDDDDK. Такой подход оказался более щадящим и не приводил к подавлению пролиферации клеток NK-92. Полученные фракции ХАР-экспрессирующих клеток были протестированы на способность подавлять рост GFP-экспрессирующих CD20+ клеток Raji. По сравнению с немодифицированными клетками, @CD20-NK-92 оказались способны подавлять пролиферацию клеток Raji в меньшей дозе (рис. 4).

ОБСУЖДЕНИЕ РЕЗУЛЬТАТОВ

В ходе сравнения различных вариантов H-гликопротеинов мы установили, что укорочение цитоплазматического домена более чем на 20 аминокислот нецелесообразно ввиду сильного падения трансфекционного титра. H/F-псевдотипированные лентивирусные частицы отличались существенно меньшей эффективностью упаковки по сравнению с лентивирусными частицами, псевдотипированными белком VSV-G, однако этот фактор компенсировался большей эффективностью на обычно сложных для трансдукции клетках NK-92. В ходе экспериментов нами было отмечено, что обработка H/F- псевдотипированными вирусными векторами приводит к менее значительному подавлению пролиферации клеток NK-92, позволяя использовать большие концентрации вирусных частиц для трансдукции и приводя к дополнительному повышению ее эффективности. Так же важно, что применительно к клеткам NK-92, BX795 оказался активен во вдвое меньших дозах, чем при трансдукции первичных культур. В целом, использование сочетания H/F-псевдотипированных лентивирусных векторов, BX795 и последующей сортировки трансдуцированных фракций на магнитных микросферах позволило нам стабильно получать популяции ХАР-экспрессирующих NK-92, демонстрирующие высокие уровни цитотоксичности против антиген-экспрессирующих клеток-мишеней.
Клетки NK-92 отличаются требовательностью к условиям культивирования и, как показали наши результаты, повышенной устойчивостью к трансдукции лентивирусными векторами. Однако сложности, связанные с получением ХАР-экспрессирующих клеток NK-92, в дальнейшем могут быть скомпенсированы большей универсальностью применения таких культур для клеточной иммунотерапии, либо в качестве компонентов комплексных терапевтических подходов, например в качестве клеточных носителей для доставки онколитических вирусов.

ВЫВОДЫ

Оптимальным вариантом белка H вируса кори для получения H/F-псевдотипированных лентивирусов является HΔ18 (с точки зрения трансфекционного титра) и 4A-HΔ24 (с точки зрения продолжительности продукции вирусных частиц), наибольшие трансфекционные титры были достигнуты при использовании соотношения плазмид 8 : 8 : 7 : 1. Полученные препараты H/F-псевдотипированных лентивирусных частиц обладали в 15–20 раз меньшим трансфекционным титром, по сравнению с VSV-G- псевдотипированными, при этом разница в титрах при трансдукции клеток NK-92 достигала приблизительно соотношения 5 : 1 в пользу H/F-псевдотипированных частиц. Определена оптимальная концентрация ингибитора TBK1/IKKɛ BX795, составившая 3 мкМ; использование BX795 позволило почти в 3 раза повысить эффективность трансдукции. Трансдуцированные клетки ХАР-NK-92 были успешно изолированы путем связывания с компонентом химерного рецептора и отличались высокой способностью подавлять пролиферацию CD20+-клеток Raji.

КОММЕНТАРИИ (0)